|
rs881375 |
SNP |
PedAM |
snpId=rs881375; pubmedId=19503088; geneId=7185; geneSymbol=TRAF1; diseaseId=umls:C0003873; sourceId=GAD; sentence=[c-Rel is an NF-kappaB family member with distinct functional properties in hematopoietic cells, and its association with rheumatoid arthritis suggests disease pathways that involve other recently identified rheumatoid arthritis susceptibility genes including CD40, TRAF1, TNFAIP3 and PRKCQ.]; score=0.311201237; Year=2009; geneSymbol_dbSNP=PHF19; CHROMOSOME=9; POS=120890620; REF=T; ALT=C |
details
|
|
|
rs881375 |
SNP |
PedAM |
snpId=rs881375; pubmedId=19503088; geneId=26147; geneSymbol=PHF19; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=REL, encoding a member of the NF-kappaB family of transcription factors, is a newly defined risk locus for rheumatoid arthritis.; score=0.122638474; Year=2009; geneSymbol_dbSNP=PHF19; CHROMOSOME=9; POS=120890620; REF=T; ALT=C |
details
|
|
|
rs909685 |
SNP |
PedAM |
snpId=rs909685; pubmedId=24390342; geneId=9145; geneSymbol=SYNGR1; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=Genetics of rheumatoid arthritis contributes to biology and drug discovery.; score=0.120271442; Year=2013; geneSymbol_dbSNP=SYNGR1; CHROMOSOME=22; POS=39351666; REF=T; ALT=A |
details
|
|
|
rs911263 |
SNP |
PedAM |
snpId=rs911263; pubmedId=24022229; geneId=1421; geneSymbol=CRYGD; diseaseId=umls:C0003873; sourceId=BeFree; sentence=One SNP, rs72928038, mapping to an intron of BACH2, achieved genome-wide significance in the meta-analysis (P = 1.2 ¡Á 10(-8), OR 1.12), and a second SNP, rs911263, mapping to an intron of RAD51B, was significantly associated in the anti-CCP-positive RA subgroup (P = 4 ¡Á 10(-8), OR 0.89), confirming that both are RA susceptibility loci.; score=0.021986792; Year=2013; geneSymbol_dbSNP=RAD51B; CHROMOSOME=14; POS=68286876; REF=C; ALT=T |
details
|
|
|
rs9138 |
SNP |
PedAM |
snpId=rs9138; pubmedId=24936586; geneId=6696; geneSymbol=SPP1; diseaseId=umls:C0003873; sourceId=BeFree; sentence=SPP1 rs9138 variant contributes to the severity of radiological damage in anti-citrullinated protein autoantibody-negative rheumatoid arthritis.; score=0.010715717; Year=2015; geneSymbol_dbSNP=SPP1; CHROMOSOME=4; POS=87983190; REF=A; ALT=C |
details
|
|
|
rs9272219 |
SNP |
PedAM |
snpId=rs9272219; pubmedId=25550865; geneId=3118; geneSymbol=HLA-DQA2; diseaseId=umls:C0003873; sourceId=BeFree; sentence=Association of HLA-DQA1 (rs9272219) with susceptibility to rheumatoid arthritis in a Han Chinese population.; score=0.123452799; Year=2014; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32634492; REF=G; ALT=T |
details
|
|
|
rs9272219 |
SNP |
PedAM |
snpId=rs9272219; pubmedId=23678157; geneId=3119; geneSymbol=HLA-DQB1; diseaseId=umls:C0003873; sourceId=BeFree; sentence=Among these associations, we found that 8 single-nucleotide polymorphisms (SNP; rs1600249, rs2736340, rs3093023, rs3093024, rs4810485, rs615672, rs660895, and rs9272219) serve as cis-effect regulators of the corresponding eQTL genes (BLK and CD4 in non-HLA region; CCR6, HLA-DQA1, and HLA-DQB1 in HLA region) that also were differentially expressed in RA-related cell groups.; score=0.051226702; Year=2014; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32634492; REF=G; ALT=T |
details
|
|
|
rs9272219 |
SNP |
PedAM |
snpId=rs9272219; pubmedId=23678157; geneId=3118; geneSymbol=HLA-DQA2; diseaseId=umls:C0003873; sourceId=BeFree; sentence=Among these associations, we found that 8 single-nucleotide polymorphisms (SNP; rs1600249, rs2736340, rs3093023, rs3093024, rs4810485, rs615672, rs660895, and rs9272219) serve as cis-effect regulators of the corresponding eQTL genes (BLK and CD4 in non-HLA region; CCR6, HLA-DQA1, and HLA-DQB1 in HLA region) that also were differentially expressed in RA-related cell groups.; score=0.123452799; Year=2014; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32634492; REF=G; ALT=T |
details
|
|
|
rs9272219 |
SNP |
PedAM |
snpId=rs9272219; pubmedId=23678157; geneId=640; geneSymbol=BLK; diseaseId=umls:C0003873; sourceId=BeFree; sentence=Among these associations, we found that 8 single-nucleotide polymorphisms (SNP; rs1600249, rs2736340, rs3093023, rs3093024, rs4810485, rs615672, rs660895, and rs9272219) serve as cis-effect regulators of the corresponding eQTL genes (BLK and CD4 in non-HLA region; CCR6, HLA-DQA1, and HLA-DQB1 in HLA region) that also were differentially expressed in RA-related cell groups.; score=0.128458305; Year=2014; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32634492; REF=G; ALT=T |
details
|
|
|
rs9276977 |
SNP |
PedAM |
snpId=rs9276977; pubmedId=19741715; geneId=3123; geneSymbol=HLA-DRB1; diseaseId=umls:C0003873; sourceId=BeFree; sentence=Conditioning on seven covariates, including HLA-DRB1 risk alleles and population structure, we identified an SNP in HLA-DOA (rs9276977) significantly associated with RA; minor allele frequency (MAF) 0.27 in cases versus 0.21 in controls, odds ratio (+/-95% confidence interval)=2.86 (1.61, 5.31).; score=0.36; Year=2010; geneSymbol_dbSNP=HLA-DOA; CHROMOSOME=6; POS=33006064; REF=G; ALT=A |
details
|
|
|
rs9296015 |
SNP |
PedAM |
snpId=rs9296015; pubmedId=21505073; geneId=10665; geneSymbol=C6orf10; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population.; score=0.129468128; Year=2011; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32251212; REF=G; ALT=A |
details
|
|
|
rs9296015 |
SNP |
PedAM |
snpId=rs9296015; pubmedId=21505073; geneId=4855; geneSymbol=NOTCH4; diseaseId=umls:C0003873; sourceId=GAD; sentence=[The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population.]; score=0.010825337; Year=2011; geneSymbol_dbSNP=NA; CHROMOSOME=6; POS=32251212; REF=G; ALT=A |
details
|
|
|
rs934734 |
SNP |
PedAM |
snpId=rs934734; pubmedId=24782177; geneId=200734; geneSymbol=SPRED2; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=Novel risk loci for rheumatoid arthritis in Han Chinese and congruence with risk variants in Europeans.; score=0.244734064; Year=2014; geneSymbol_dbSNP=SPRED2; CHROMOSOME=2; POS=65368452; REF=G; ALT=A |
details
|
|
|
rs934734 |
SNP |
PedAM |
snpId=rs934734; pubmedId=20453842; geneId=200734; geneSymbol=SPRED2; diseaseId=umls:C0003873; sourceId=GAD; sentence=[Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci.]; score=0.244734064; Year=2010; geneSymbol_dbSNP=SPRED2; CHROMOSOME=2; POS=65368452; REF=G; ALT=A |
details
|
|
|
rs934734 |
SNP |
PedAM |
snpId=rs934734; pubmedId=20453842; geneId=200734; geneSymbol=SPRED2; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci.; score=0.244734064; Year=2010; geneSymbol_dbSNP=SPRED2; CHROMOSOME=2; POS=65368452; REF=G; ALT=A |
details
|
|
|
rs9372120 |
SNP |
PedAM |
snpId=rs9372120; pubmedId=24390342; geneId=9474; geneSymbol=ATG5; diseaseId=umls:C0003873; sourceId=GWASCAT; sentence=Genetics of rheumatoid arthritis contributes to biology and drug discovery.; score=0.120542884; Year=2013; geneSymbol_dbSNP=ATG5; CHROMOSOME=6; POS=106219660; REF=T; ALT=G |
details
|
|
|
rs9373594 |
SNP |
PedAM |
snpId=rs9373594; pubmedId=24390342; geneId=85313; geneSymbol=PPIL4; diseaseId=umls:C0003873; sourceId=NA; sentence=NA; score=NA; Year=NA; geneSymbol_dbSNP=NA; CHROMOSOME=NA; POS=NA; REF=NA; ALT=NA |
details
|
|
|
hsa_circ_0088036 |
circRNA |
Circ2Disease |
circRNA_name=hsa_circ_0088036; Synonyms=hsa_circRNA_104871; Chromosome=9; Position=114840817-114842445; Strand=-; Genome_Version=hg19; Gene_symbol=SUSD1; Circ_Sequence=TAAAACAGACCATCAGTAACATTTCAGGATTTAATGAAACCTGCTTGAGATGGAGAAGCATCAAGACAGCTGATATGGAGGAGATGTATTTATTCCACATTTGGGGCCAGAGATGGTATCAGAAGGAATTTGCCCAGGAAATGACCTTTAATATCAGTAGCAGCAGCCGAGATCCCGAGGTGTGCTTGGACCTACGTCCGGGTACCAACTACAATGTCAGTCTCCGGGCTCTGTCTTCGGAACTTCCTGTGGTCATCTCCCTGACAACCCAGATAACAG; Circ_Type=exonic; Disease_name=rheumatoid arthritis; Methods=microarray; qRT-PCR; Sample=PBMCs from 35 patients with RA and 30 healthy controls; Location=N/A; Expression_pattern=up-regulated; miRNA=N/A; miRNA_Target=N/A; RBP=N/A; RBP_Target=N/A; Functional_description=We identified and verified five circRNAs (092516, 003524, 103047, 104871, 101873) that were significantly elevated in PBMCs from RA patients. Among these RA patients, we detected no significant correlation between the five circRNAs and the disease severity, including disease activity score (DAS28), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and health assessment questionnaire (HAQ). Yet, ROC curve analysis suggested that circRNA_104871 has significant value of RA diagnosis (AUC=0.833, P<0.001), followed by circRNA_003524 (AUC = 0.683, P = 0.020), circRNA_101873 (AUC = 0.676, P = 0.026), and circRNA_103047 (AUC = 0.671, P = 0.030). This study suggests that increased expression of circRNAs circRNA_104871, circRNA_003524, circRNA_101873 and circRNA_103047 in PBMC from RA patients may serve as potential biomarkers for RA patient diagnosis.; PubMed_ID=28618429; Pub_Year=2017; Journal=Cell Physiol Biochem; Title=Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients; Notes=N/A; UpGene=NA; DownGene=NA; Regulation_Description=NA; NA |
details
|
|
|
hsa_circ_0003524 |
circRNA |
Circ2Disease |
circRNA_name=hsa_circ_0003524; Synonyms=hsa_circRNA_003524; Chromosome=2; Position=131829427-131840230; Strand=-; Genome_Version=hg19; Gene_symbol=FAM168B; Circ_Sequence=TTTTTGAAATCATGAATCCTGTTTATAGTCCTGGATCTTCTGGGGTTCCCTATGCAAATGCCAAAGGAATTGGTTATCCAGCTGGTTTTCCCATGGGCTATGCAGCAGCAGCTCCTGCCTATTCTCCTAACATGTATCCTGGAGCGAATCCTACCTTCCAAACAG; Circ_Type=exonic; Disease_name=rheumatoid arthritis; Methods=microarray; qRT-PCR; Sample=PBMCs from 35 patients with RA and 30 healthy controls; Location=N/A; Expression_pattern=up-regulated; miRNA=N/A; miRNA_Target=N/A; RBP=N/A; RBP_Target=N/A; Functional_description=We identified and verified five circRNAs (092516, 003524, 103047, 104871, 101873) that were significantly elevated in PBMCs from RA patients. Among these RA patients, we detected no significant correlation between the five circRNAs and the disease severity, including disease activity score (DAS28), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and health assessment questionnaire (HAQ). Yet, ROC curve analysis suggested that circRNA_104871 has significant value of RA diagnosis (AUC=0.833, P<0.001), followed by circRNA_003524 (AUC = 0.683, P = 0.020), circRNA_101873 (AUC = 0.676, P = 0.026), and circRNA_103047 (AUC = 0.671, P = 0.030). This study suggests that increased expression of circRNAs circRNA_104871, circRNA_003524, circRNA_101873 and circRNA_103047 in PBMC from RA patients may serve as potential biomarkers for RA patient diagnosis.; PubMed_ID=28618429; Pub_Year=2017; Journal=Cell Physiol Biochem; Title=Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients; Notes=N/A; UpGene=NA; DownGene=NA; Regulation_Description=NA; details=circRNA_name=hsa_circ_0088036; Synonyms=hsa_circRNA_104871; Chromosome=9; Position=114840817-114842445; Strand=-; Genome_Version=hg19; Gene_symbol=SUSD1; Circ_Sequence=TAAAACAGACCATCAGTAACATTTCAGGATTTAATGAAACCTGCTTGAGATGGAGAAGCATCAAGACAGCTGATATGGAGGAGATGTATTTATTCCACATTTGGGGCCAGAGATGGTATCAGAAGGAATTTGCCCAGGAAATGACCTTTAATATCAGTAGCAGCAGCCGAGATCCCGAGGTGTGCTTGGACCTACGTCCGGGTACCAACTACAATGTCAGTCTCCGGGCTCTGTCTTCGGAACTTCCTGTGGTCATCTCCCTGACAACCCAGATAACAG; Circ_Type=exonic; Disease_name=rheumatoid arthritis; Methods=microarray; qRT-PCR; Sample=PBMCs from 35 patients with RA and 30 healthy controls; Location=N/A; Expression_pattern=up-regulated; miRNA=N/A; miRNA_Target=N/A; RBP=N/A; RBP_Target=N/A; Functional_description=We identified and verified five circRNAs (092516, 003524, 103047, 104871, 101873) that were significantly elevated in PBMCs from RA patients. Among these RA patients, we detected no significant correlation between the five circRNAs and the disease severity, including disease activity score (DAS28), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and health assessment questionnaire (HAQ). Yet, ROC curve analysis suggested that circRNA_104871 has significant value of RA diagnosis (AUC=0.833, P<0.001), followed by circRNA_003524 (AUC = 0.683, P = 0.020), circRNA_101873 (AUC = 0.676, P = 0.026), and circRNA_103047 (AUC = 0.671, P = 0.030). This study suggests that increased expression of circRNAs circRNA_104871, circRNA_003524, circRNA_101873 and circRNA_103047 in PBMC from RA patients may serve as potential biomarkers for RA patient diagnosis.; PubMed_ID=28618429; Pub_Year=2017; Journal=Cell Physiol Biochem; Title=Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients; Notes=N/A; UpGene=NA; DownGene=NA; Regulation_Description=NA; NA |
details
|
|
|
hsa_circ_0004315 |
circRNA |
Circ2Disease |
circRNA_name=hsa_circ_0004315; Synonyms=hsa_circRNA_101873; Chromosome=16; Position=74491771-74493687; Strand=-; Genome_Version=hg19; Gene_symbol=GLG1; Circ_Sequence=ATCTCCAGTCTATGTGCTGAAGAAGCAGCAGCCCAAGAGCAGACAGGTCAGGTGGAGGAGTGCCTCAAGGTCAACCTGCTCAAGATCAAAACAGAATTGTGTAAAAAGGAAGTGCTAAACATGCTGAAGGAAAGCAAAGCAGACATCTTTGTTGACCCGGTACTTCATACTGCTTGTGCCCTGGACATTAAACACCACTGCGCAGCCATCACCCCTGGCCGCGGGCGTC; Circ_Type=exonic; Disease_name=rheumatoid arthritis; Methods=microarray; qRT-PCR; Sample=PBMCs from 35 patients with RA and 30 healthy controls; Location=N/A; Expression_pattern=up-regulated; miRNA=N/A; miRNA_Target=N/A; RBP=N/A; RBP_Target=N/A; Functional_description=We identified and verified five circRNAs (092516, 003524, 103047, 104871, 101873) that were significantly elevated in PBMCs from RA patients. Among these RA patients, we detected no significant correlation between the five circRNAs and the disease severity, including disease activity score (DAS28), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and health assessment questionnaire (HAQ). Yet, ROC curve analysis suggested that circRNA_104871 has significant value of RA diagnosis (AUC=0.833, P<0.001), followed by circRNA_003524 (AUC = 0.683, P = 0.020), circRNA_101873 (AUC = 0.676, P = 0.026), and circRNA_103047 (AUC = 0.671, P = 0.030). This study suggests that increased expression of circRNAs circRNA_104871, circRNA_003524, circRNA_101873 and circRNA_103047 in PBMC from RA patients may serve as potential biomarkers for RA patient diagnosis.; PubMed_ID=28618429; Pub_Year=2017; Journal=Cell Physiol Biochem; Title=Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients; Notes=N/A; UpGene=NA; DownGene=NA; Regulation_Description=NA; details=circRNA_name=hsa_circ_0088036; Synonyms=hsa_circRNA_104871; Chromosome=9; Position=114840817-114842445; Strand=-; Genome_Version=hg19; Gene_symbol=SUSD1; Circ_Sequence=TAAAACAGACCATCAGTAACATTTCAGGATTTAATGAAACCTGCTTGAGATGGAGAAGCATCAAGACAGCTGATATGGAGGAGATGTATTTATTCCACATTTGGGGCCAGAGATGGTATCAGAAGGAATTTGCCCAGGAAATGACCTTTAATATCAGTAGCAGCAGCCGAGATCCCGAGGTGTGCTTGGACCTACGTCCGGGTACCAACTACAATGTCAGTCTCCGGGCTCTGTCTTCGGAACTTCCTGTGGTCATCTCCCTGACAACCCAGATAACAG; Circ_Type=exonic; Disease_name=rheumatoid arthritis; Methods=microarray; qRT-PCR; Sample=PBMCs from 35 patients with RA and 30 healthy controls; Location=N/A; Expression_pattern=up-regulated; miRNA=N/A; miRNA_Target=N/A; RBP=N/A; RBP_Target=N/A; Functional_description=We identified and verified five circRNAs (092516, 003524, 103047, 104871, 101873) that were significantly elevated in PBMCs from RA patients. Among these RA patients, we detected no significant correlation between the five circRNAs and the disease severity, including disease activity score (DAS28), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and health assessment questionnaire (HAQ). Yet, ROC curve analysis suggested that circRNA_104871 has significant value of RA diagnosis (AUC=0.833, P<0.001), followed by circRNA_003524 (AUC = 0.683, P = 0.020), circRNA_101873 (AUC = 0.676, P = 0.026), and circRNA_103047 (AUC = 0.671, P = 0.030). This study suggests that increased expression of circRNAs circRNA_104871, circRNA_003524, circRNA_101873 and circRNA_103047 in PBMC from RA patients may serve as potential biomarkers for RA patient diagnosis.; PubMed_ID=28618429; Pub_Year=2017; Journal=Cell Physiol Biochem; Title=Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Rheumatoid Arthritis Patients; Notes=N/A; UpGene=NA; DownGene=NA; Regulation_Description=NA; NA |
details
|
|
